Google Genomics could prove more significant than any of these moonshots. Connecting and comparing genomes by the thousands, and soon by the millions, is what’s going to propel medical discoveries for the next decade. The question of who will store the data is already a point of growing competition between Amazon, Google, IBM, and Microsoft.
This seems like a great technology to help advance medicine, but this being Google, one does have to wonder just what Google will do with data like this – or, better put, what can be done with data like this at all beyond its intended and promised purpose.
I’m glad that google is going to store it because I’m running out of space on my hard-drive, ever since I started using SSD drives.
I guess, to deduce anything from these genomes, you must attach to each one as much information as possible on the individual : sex, ethnicity, past diseases and chronical problems, parents and grandparents age or cause of death, allergies, weight, smoking habits,… Of course, families genomes should be interlinked…
What could possibly go wrong, giving to Google that information ?
Edited 2014-11-08 00:17 UTC
..based on your genetic code.
No one in their right mind should trust an advertising company with their most personal information. Google should spin off their new ideas into a separate company to reassure people that it is a totally different operation from their advertising business
Yeah, get your new ATCCGCTAAAGCTCGATTCG today with an incredible bargain !
Oooops, we meant ATCCGCTTAAGCTCGATTCG, never mind for your third eye…
Kochise
You mean they should start acting like a responsible company who respect privacy?
Sadly they’ll probably provide a “free” service and most people will overlook the implications.
I genuinely can’t think of a company I’d be more against collecting my medical data.
In my sack storage. I don’t need Google help with that.
Since these are all american companies I prefer to let americans put their genom with those.
I at least try to avoid google etc. as much as I can, but to “save” yourself for the “ads-monster” one needs about 7 addons in firefox and at least 3 different alternative search-engines. Doesn’t that show how sick it all is?
Google, Amazon, Microsoft???? To take care of the medical and genetic data of millions of people????
It really sounds like the worst plan ever. That data, if it can be very useful for medical purposes should be kept in some medical research centre. Usually some public institution, preferably in the EU.
Who even thought that Amazon (Google, Microsoft, IBM, Apple, whatever) could handle such data???
I think the only question that matters is if they will be keeping personally identifying data along with the genome data. If not, I don’t really see a problem.
Of course the raises the question of what constitutes personally identifying data. You would expect such a system to keep descriptive data, like physical attributes, age and diseases. Of these data, the only thing I can think of that can be used to identify people is rare diseases. But people with rare diseases are pretty much known about if they are in long term treatment anyway.
IF google (or amazon, facebook) – or other private organisations, or indeed governmental organisations with big data handling/mining capabilities, and an (vested or otherwise) “interest” in organising, filtering, providing analysis tools for etc OUR collective genome sequences data — then how cautious/scared/thankful/delighted we ought to be SHOULD, and this is my recommendation, correlate highly to the access, both on average worldwide, and to us all locally, to high quality free (at the point of use) Health Care / National Health Services.
Even in the UK and Europe, this health care model is currently being pressured highly by righter wing political parties and lobbies from medical insurance, big pharma, and private medical providers. The U.S. is as we all know far worse even. Until this changes or is reversed – I’d caution against ANY institute obtaining genomes en masse. Sadly.
That said – if this happens – which no doubt it will eventually.
Large scale genomic database collation (and concomitant access provisions and tool generation) – should really be UN/WHO led, or a new division thereof
— with consultation/service provision from industry (goog, fb, amzn, msft, ibm). And consultation, and binding agreement and oversight from world governments, and their populae.
….yeah i’m a dreamer. but i’m still right. 😉
Having this information all in one place might yield some interesting advancements in medicine, however having it all in one place can also lead to some really nasty consequences.
It doesn’t really matter who gets to store the data or how many safeguards are put in place, it has a real potential to be abused either by governments or agencies thereof or by some corporation looking for profits. It has been shown before that mass collection of detailed personal info can turn sour, we should learn from history.
For your info:
Google is already a big investor of 23andme.com, an online genome testing company.
Not only that but it was founded by Sergei Brin’s wife in person!
Pretending that Google doesn’t have “legal access” is merely semantics at this point. Google both fund and founded (by proxy) the company, you think they care about a legal technicality? They didn’t even bother to fill the FDA paperwork and got shut down in the USA!
Edited 2014-11-09 03:54 UTC
OTOH they shut down Google Health some years back…
Well, now we know what part of that new NSA data storage farm is going to be used for. And just imagine all the money-making opportunity that will come along with this genome collection!
Next stop, Minority Report.
I don’t need someone to store it. I always keep it with me.
I would like to submit my genome data. Where can I get it sequenced?